3 billion years of evolution in 3,500 words
Swapping genes during sex helps organisms weed out the bad mutations from the good (Image: Laguna Design/Science Photo Library)
GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCAGTTAAAAAG
It looks like gibberish, but this DNA sequence is truly remarkable. It is present in all the cells of your body, in your cat or dog, the fish on your plate, the bees and butterflies in your garden and in the bacteria in your gut. In fact, wherever you find life on Earth, from boiling hot vents deep under the sea to frozen bacteria in the clouds high above the planet, you find this sequence. You can even find it in some things that aren’t technically alive, such as the giant viruses known as mimiviruses.
This sequence is so widespread because it evolved in the common ancestor of all life, and as it carries out a crucial process, it has barely changed ever since. Put another way, some of your DNA is an unimaginable 3 billion years old, passed down to you in an unbroken chain by your trillions of ancestors…
Read A brief history of the human genome by Michael Le Page in New Scientist. (Registration required)
We especially like this part:
Our evolution has come at a tremendous cost. They say history is written by the victors – well, our genome is a record of victories, of the experiments that succeeded or least didn’t kill our ancestors. We are the descendants of a long line of lottery winners, a lottery in which the prize was producing offspring that survived long enough to reproduce themselves. Along the way, there were uncountable failures, with trillions of animals dying often horrible deaths.
Our genome is far from a perfectly honed, finished product. Rather, it has been crudely patched together from the detritus of genetic accidents and the remains of ancient parasites. It is the product of the kind of crazy, uncontrolled experimentation that would be rejected out of hand by any ethics board. And this process continues to this day – go to any hospital and you’ll probably find children dying of horrible genetic diseases. But not as many are dying as would have happened in the past. Thanks to methods such as embryo screening, we are starting to take control of the evolution of the human genome. A new era is dawning.
Answers to questions you might be asking, unless you wandered onto this site purely by accident >>>
