JessicaRulestheUniverse.com

Swapping genes during sex helps organisms weed out the bad mutations from the good (Image: Laguna Design/Science Photo Library)

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCAGTTAAAAAG

This sequence is so widespread because it evolved in the common ancestor of all life, and as it carries out a crucial process, it has barely changed ever since. Put another way, some of your DNA is an unimaginable 3 billion years old, passed down to you in an unbroken chain by your trillions of ancestors…

Read A brief history of the human genome by Michael Le Page in New Scientist. (Registration required)

We especially like this part:

Our evolution has come at a tremendous cost. They say history is written by the victors – well, our genome is a record of victories, of the experiments that succeeded or least didn’t kill our ancestors. We are the descendants of a long line of lottery winners, a lottery in which the prize was producing offspring that survived long enough to reproduce themselves. Along the way, there were uncountable failures, with trillions of animals dying often horrible deaths.

Our genome is far from a perfectly honed, finished product. Rather, it has been crudely patched together from the detritus of genetic accidents and the remains of ancient parasites. It is the product of the kind of crazy, uncontrolled experimentation that would be rejected out of hand by any ethics board. And this process continues to this day – go to any hospital and you’ll probably find children dying of horrible genetic diseases. But not as many are dying as would have happened in the past. Thanks to methods such as embryo screening, we are starting to take control of the evolution of the human genome. A new era is dawning.

Jupiter may just have saved Earth from a cosmic collision.

Physicists say they have “teleported” quantum information farther than ever before.

A team of scientists from Austria, Canada and Germany say they beamed the quantum state of a particle of light from one island to another 89 miles (143 kilometers) away.

Read Distance record set for quantum teleportation.

PEOPLE explode. One minute they may be relaxing in a chair, the next they erupt into a fireball. Jets of blue fire shoot from their bodies like flames from a blowtorch, and within half an hour they are reduced to a pile of ash. Typically, the legs remain unscathed, sticking out grotesquely from the smoking cinders. Nearby objects (a pile of newspapers on the armrest, for example) are untouched. Greasy fat lies on the floor. For centuries, this gruesome way of death has been debated, with many people discounting it as a myth. But spontaneous human combustion is real and we think we can show how it happens.

The first accounts date from 1641, when Danish doctor and mathematician Thomas Bartholin described the death of Polonus Vorstius – who drank wine at home in Milan, Italy, one evening in 1470 before bursting into flames. In 1663, Bartholin wrote of a Parisian woman who burned, leaving the mattress on which she lay unscathed. And in the Philosophical Transactions of 1745, Paul Rolli told how 62-year-old Countess Cornelia Bandi of Ceséna, Italy, said she felt “dull and heavy” after dining and went to bed. Next morning, her maid found a pile of ash with her legs protruding from the smouldering remains.

Read Big Burn Theory in New Scientist (Registration required)

Neil Armstrong, the first man to set foot on the Moon, has died at the age of 82. And the world mourns the loss of a man who achieved something no other human can ever do — to take the first steps on a world other than the Earth.

Remembering Neil Armstrong

Not safe sex, as the church would have us believe, but climate change.

Click on image to enlarge

Some view even this notion as too simplistic. Karl Butzer of the University of Texas at Austin, who has studied the collapse of civilisations, thinks the role of climate has been exaggerated. It is the way societies handle crises that decides their fate, he says. “Things break through institutional failure.” When it comes to the Akkadians, for instance, Butzer says not all records support the idea of a megadrought.

In the case of the Maya, though, the evidence is strong. Earlier this year, Eelco Rohling of the University of Southampton, UK, used lake sediments and isotope ratios in stalactites to work out how rainfall had changed. He concluded that annual rainfall fell 40 per cent over the prolonged dry period, drying up open water sources. This would have seriously affected the Maya, he says, because the water table lay far underground and was effectively out of reach…
(more…)