JessicaRulestheUniverse.com

In Emotional Weather Report, our column in the Philippine Star, 22 Sept 2012

On Monday afternoons Bel-Air Village homeowner Tracy Tuason boards a van from CARA and goes around the neighborhood catching cats. CARA—Compassion and Responsibility for Animals—is a non-government, non-profit, volunteer-run organization which advocates animal welfare. Bel-Air in Makati, like most neighborhoods, has a population of stray cats. Acting on reports called in by the residents, Tracy and the staff from CARA round up stray cats and bring them to the “cat condominium” behind the Barangay Hall.

The cat condominium at the Bel-Air Barangay office, where cats are sent to recover after they are spayed or neutered. Photos by JZ

The following day the cats are taken to the CARA clinic in Singalong, where volunteer veterinarian Dr. Riza Zunio attends to them. The female cats are spayed (their ovaries are removed, as in a hysterectomy) and the males neutered (castrated) so they will no longer produce kittens. In theory, a pair of cats can produce up to16 kittens in one year, 128 in two years, and 67,000 in six years—a population explosion. Spaying and neutering not only keeps the feline population in check, but it makes the cats less prone to disease. It lowers the risk of breast cancer in females, especially if they are spayed early enough, and prevents severe uterine infection. It also reduces the danger of testicular and prostate problems in males.

This cutie will be spayed or neutered when he (she?) is a little older.
(more…)

Judge Dredd: Crusade and Frankenstein Division by Morrison-Millar-Esquerra-Austin, Php794 at National Bookstores.

A Mega-City One Judge who vanished on a space mission 15 years earlier suddenly sends a transmission to base: he has spoken to God. Then his ship crashes in the Antarctic. All the Mega-Cities dispatch their best Judges to the crash site to recover whatever he found in space. Naturally they’ll have to fight for the thing, and only one Judge will survive. Will it be Dredd, or that nasty Inquisitor Cesare from the Vatican? Bloody mayhem ensues, but we didn’t have to point that out.

Batman: Death by Design by Chip Kidd and Dave Taylor, hardcover Php1015 at National Bookstores.

Imagine a Batman movie from the 1930s or 40s, black and white, starring Gary Cooper as Bruce Wayne and Grace Kelly as a socialite campaigning to preserve important buildings. Throw in an intrepid reporter, an embittered genius, a self-promoting artist-celebrity (Kem Roomhaus hehe), a corrupt union boss, a certain mass-murdering psychotic, and an ambitious architectural project. Enjoy.

Structured Procrastination by John Perry, winner of the 2011 Ig Nobel Prize for Literature

I have been intending to write this essay for months. Why am I finally doing it? Because I finally found some uncommitted time? Wrong. I have papers to grade, textbook orders to fill out, an NSF proposal to referee, dissertation drafts to read. I am working on this essay as a way of not doing all of those things. This is the essence of what I call structured procrastination, an amazing strategy I have discovered that converts procrastinators into effective human beings, respected and admired for all that they can accomplish and the good use they make of time. All procrastinators put off things they have to do. Structured procrastination is the art of making this bad trait work for you. The key idea is that procrastinating does not mean doing absolutely nothing.

Read on. Especially if you should be doing something else entirely.

Dredd. Brusque, extremely violent, hardly original but efficient. (No, we have not seen The Raid.) Life after apocalypse: bleak and decrepit. All we see of Karl Urban is his chin and he’s still badass. As he is battling Cersei Lannister (Lena Headey) he’d better be. Oddly, the humor comes from Dredd’s total absence of humor.

Ruby Sparks. Viewer barfs. Eet toe cute we want to euthanize them. There’s a way to do surreal: Charlie Kaufman does it, Spike Jonze, Wes Anderson. Woody Allen does it all the time. What you do is, you carry on as if nothing is out of the ordinary. You don’t point it out constantly like a freshman doing a book report.

Swapping genes during sex helps organisms weed out the bad mutations from the good (Image: Laguna Design/Science Photo Library)

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCAGTTAAAAAG

This sequence is so widespread because it evolved in the common ancestor of all life, and as it carries out a crucial process, it has barely changed ever since. Put another way, some of your DNA is an unimaginable 3 billion years old, passed down to you in an unbroken chain by your trillions of ancestors…

Read A brief history of the human genome by Michael Le Page in New Scientist. (Registration required)

We especially like this part:

Our evolution has come at a tremendous cost. They say history is written by the victors – well, our genome is a record of victories, of the experiments that succeeded or least didn’t kill our ancestors. We are the descendants of a long line of lottery winners, a lottery in which the prize was producing offspring that survived long enough to reproduce themselves. Along the way, there were uncountable failures, with trillions of animals dying often horrible deaths.

Our genome is far from a perfectly honed, finished product. Rather, it has been crudely patched together from the detritus of genetic accidents and the remains of ancient parasites. It is the product of the kind of crazy, uncontrolled experimentation that would be rejected out of hand by any ethics board. And this process continues to this day – go to any hospital and you’ll probably find children dying of horrible genetic diseases. But not as many are dying as would have happened in the past. Thanks to methods such as embryo screening, we are starting to take control of the evolution of the human genome. A new era is dawning.